View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10049A_low_296 (Length: 239)
Name: NF10049A_low_296
Description: NF10049A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10049A_low_296 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 136; Significance: 4e-71; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 73 - 224
Target Start/End: Complemental strand, 22837938 - 22837787
Alignment:
| Q |
73 |
aagaaaagaaatcataccatgaagaagccgaaacaagctaccattaaccatgtaatcaaagacaagcaatttttcatctcttgcaaaataataagccttt |
172 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
22837938 |
aagaaaagaaatcataccatgaagaagccaaaacaagctaccattaaccatgtaatcaaagacaagcaatttttcatcccttgcaaaataataagccttt |
22837839 |
T |
 |
| Q |
173 |
aagctaacaatgttggagtgtcttaactttccaagaacttccattctctgct |
224 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
22837838 |
aagctaacaatgttggagtgttttaactttccaagaatttccattctctgct |
22837787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University