View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10049A_low_299 (Length: 238)
Name: NF10049A_low_299
Description: NF10049A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10049A_low_299 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 127; Significance: 1e-65; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 36 - 166
Target Start/End: Original strand, 43921966 - 43922096
Alignment:
| Q |
36 |
tgttattgaaagtgaagagtagaatcgataagatactagtggtgcaattacggattctagtgcgatcgatgataataagagaggtgaaatgaataaaaaa |
135 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43921966 |
tgttattgaaagtgaaaagtagaatcgataagatactagtggtgcaattacggattctagtgcgatcgatgataataagagaggtgaaatgaataaaaaa |
43922065 |
T |
 |
| Q |
136 |
ggagatagaaattgaaaccttgattttcatc |
166 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
43922066 |
ggagatagaaattgaaaccttgattttcatc |
43922096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University