View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10049A_low_305 (Length: 237)
Name: NF10049A_low_305
Description: NF10049A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10049A_low_305 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 100; Significance: 1e-49; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 1 - 232
Target Start/End: Original strand, 25014561 - 25014792
Alignment:
| Q |
1 |
gaagcaaatggcataacaatgccaatagaacaattagtgaattcaaacctgctttgact-tgaataatttaaaactgaacattagcaccattccacaata |
99 |
Q |
| |
|
||||||||||||||||||||||||| || | ||||||||||||| |||||| | || || | ||||||| ||| |||||||||| ||||||| ||| |
|
|
| T |
25014561 |
gaagcaaatggcataacaatgccaaaagcagcattagtgaattcacgtctgctt-gtctctgcaaaatttaacacttaacattagcattattccactata |
25014659 |
T |
 |
| Q |
100 |
gagaaattaaagaaccnnnnnnntttcactcattaggttaaaccgcggaatttgaaaaagacctgcaactacaatttaggccgcaatatcaatannnnnn |
199 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
25014660 |
gagaaattaaagaactaaaaaaatttcactcattaggttaaaccgcggaatttgaaaaagacctgcaactgcaatttaggccgcaatatcaatatttttt |
25014759 |
T |
 |
| Q |
200 |
nnaatattgaatcctggttatctgaactccaaa |
232 |
Q |
| |
|
|||||||||||||||||||| |||||||||| |
|
|
| T |
25014760 |
ttaatattgaatcctggttatccgaactccaaa |
25014792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University