View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10049A_low_308 (Length: 235)
Name: NF10049A_low_308
Description: NF10049A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10049A_low_308 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 4 - 229
Target Start/End: Original strand, 43953631 - 43953856
Alignment:
| Q |
4 |
tgtggtttaatggcagcggctactaaacaagtgccaagagaaattcatggacggactaacttaagtcaaattgtgttggacacaaacaagtgcatattcg |
103 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43953631 |
tgtggtttaatggcggcggctactaaacaagtgccaagagaaattcatggacggactaacttaagtcaaattgtgttggacacaaacaagtgcatattcg |
43953730 |
T |
|
| Q |
104 |
gatggatccaatgagacatatctatccaacaaaaggtggtggttaataaacaagtaccattataatttcccattctgttggcaaaaaggcaaggagacta |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||| |
|
|
| T |
43953731 |
gatggatccaatgagacatatctatccaacaaaaggtggtggttaataaacaagtaccattataattgcccatgctgttggcaaaaaggcaaggagacta |
43953830 |
T |
|
| Q |
204 |
gcaaagatgtctccaacagtgaggct |
229 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
43953831 |
gcaaagatgtctccaacagtgaggct |
43953856 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University