View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10049A_low_309 (Length: 235)
Name: NF10049A_low_309
Description: NF10049A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10049A_low_309 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 1 - 228
Target Start/End: Complemental strand, 34142442 - 34142215
Alignment:
| Q |
1 |
aatgactattaaattaaccgtccctctttgagcttgtttatacattattatatagtttatacaattaattgattttgcctcacaaactgggtttttggta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34142442 |
aatgactattaaattaaccgtccctctttgagcttgtttatacattattatatagtttatacaattaattgattttgcctcacaaactgggtttttggta |
34142343 |
T |
|
| Q |
101 |
gcaagattatagttgcaaatgagtagagctagttcaatgatttttgaatgcttgttattttccatctgatcaaatgctaagttgctaacatgttttgcat |
200 |
Q |
| |
|
|||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34142342 |
gcaagattatggttgcaaatgcgtagagctagttcaatgatttttgaatgcttgttattttccatctgatcaaatgctaagttgctaacatgttttgcat |
34142243 |
T |
|
| Q |
201 |
attgatatttgtggttttcagaacacca |
228 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
34142242 |
attgatatttgtggttttcagaacacca |
34142215 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University