View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10049A_low_312 (Length: 233)
Name: NF10049A_low_312
Description: NF10049A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10049A_low_312 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 19 - 211
Target Start/End: Original strand, 34344746 - 34344938
Alignment:
| Q |
19 |
aatatccaaggtggctccaaatttgtctttgaaggaggatgcaaaggtttgaatagaatcagcatctgagacatcaaggactagaaagtgaacatgatga |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34344746 |
aatatccaaggtggctccaaatttgtctttgaaggaggatgcaaaggttttaatagaatcagcatctgagacatcaaggactagaaagtgaacatgatga |
34344845 |
T |
|
| Q |
119 |
tgaggtgcaacaaggcctaattgtgctcgaatcatctccacagcatcctctcctttcttcttgtctctagcagttaacactacactcagtccc |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34344846 |
tgaggtgcaacaaggcctaattgtgctcgaattctctccacagcatcctctcctttcttcttgtctctagcagttaacactacactcagtccc |
34344938 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University