View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10049A_low_314 (Length: 233)
Name: NF10049A_low_314
Description: NF10049A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10049A_low_314 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 23 - 229
Target Start/End: Complemental strand, 16458766 - 16458560
Alignment:
| Q |
23 |
gtttggtgttgcttcaagcaagagttcgtggacaaagagaaaggagtatgtgaaactatggtggaaaaacaacaatgcaatgaagggttgtgtgtttttg |
122 |
Q |
| |
|
||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16458766 |
gtttggtattgcttcaagcaagagttcatggacaaagagaaaggagtatgtgaaactatggtggaaaaacaacaatgcaatgaagggttgtgtgtttttg |
16458667 |
T |
|
| Q |
123 |
gatagtttaccacaaaatgacgatgacccttcttctcttcctcctctatgtgtctccgaagacacttcgcggtttcgatatacttgcaaggatggacttc |
222 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| | |||||||| |
|
|
| T |
16458666 |
gatagtttaccacaaaatgaagatgacccttcttctcttcctcctctatgtgtctccgaagacacttcgcggtttcaatatacttgcaaaggtggacttc |
16458567 |
T |
|
| Q |
223 |
gctcagc |
229 |
Q |
| |
|
| ||||| |
|
|
| T |
16458566 |
gatcagc |
16458560 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University