View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10049A_low_315 (Length: 232)
Name: NF10049A_low_315
Description: NF10049A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10049A_low_315 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 10 - 223
Target Start/End: Complemental strand, 33261386 - 33261173
Alignment:
| Q |
10 |
gagctaactgaagtgcctactcctctaaccaaggatgggtgatgcccatagctaggaggtattgcagccctagacccataaaattaaattataacttagt |
109 |
Q |
| |
|
|||||||||||| |||||||||| | ||||||| ||||||| ||||||||||||| | |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33261386 |
gagctaactgaattgcctactccaccaaccaagtatgggtgttgcccatagctagagcgcattgcagccctagacccataaaattaaattataacttagt |
33261287 |
T |
|
| Q |
110 |
tagataatcaactaacatataagcaagtaagatttctagtttaatcatgaaaattcagcacgtacacagaagcagcaacatctgcaggcattacgggtct |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33261286 |
tagataatcaactaacatataagcaagtaagatttctagtttaatcatgaaaattcagcacgtacacagaagcagcaacatctgcaggcattacgggtct |
33261187 |
T |
|
| Q |
210 |
gtaagcatattgtt |
223 |
Q |
| |
|
|||||||| ||||| |
|
|
| T |
33261186 |
gtaagcattttgtt |
33261173 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University