View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10049A_low_331 (Length: 230)
Name: NF10049A_low_331
Description: NF10049A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10049A_low_331 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 225
Target Start/End: Complemental strand, 16458596 - 16458372
Alignment:
| Q |
1 |
ggtttcgatatacttgcaaaggtggacttcgatcagctatccgggtggcacgtgttgtcgcggagactgtagccttgaatcattcaaatgtgaagtggta |
100 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
16458596 |
ggtttcaatatacttgcaaaggtggacttcgatcagctatccgggtggcacgtgttgtcgcggagactgtagccttgaatcattcaaatgtaaagtggta |
16458497 |
T |
 |
| Q |
101 |
tgtgtttggagacgacgacacggttttcttcccggagaatttggtgaagactctttctaaatatgatcatgagctttggtattatattggtgcacactct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16458496 |
tgtgtttggagacgacgacacggttttcttcccggagaatttggtgaagactctttctaaatatgatcatgagctttggtattatattggtgcacactct |
16458397 |
T |
 |
| Q |
201 |
gagatttatgagcagaatcgtttgt |
225 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
16458396 |
gagatttatgagcagaatcgtttgt |
16458372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 75 - 170
Target Start/End: Complemental strand, 37515221 - 37515126
Alignment:
| Q |
75 |
ttgaatcattcaaatgtgaagtggtatgtgtttggagacgacgacacggttttcttcccggagaatttggtgaagactctttctaaatatgatcat |
170 |
Q |
| |
|
||||||||||| |||| | ||||||||||||||| || || ||||| ||||||| || |||||| | || ||||| |||||||||||||||||| |
|
|
| T |
37515221 |
ttgaatcattctgatgttaggtggtatgtgtttggtgatgatgacacaattttctttcctgagaatcttgttaagacactttctaaatatgatcat |
37515126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University