View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10049A_low_333 (Length: 230)
Name: NF10049A_low_333
Description: NF10049A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10049A_low_333 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 1 - 225
Target Start/End: Original strand, 32189623 - 32189827
Alignment:
Q |
1 |
gattttatgtcattaccatgattaatgcatcgactatgatatatagacctggatcttttgtagctagctacaaatggttagattacaagagaacaattga |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
T |
32189623 |
gattttatgtcattaccatgattaatgcatcgactatgatatatagacctggat--------------------tggttagattacaagagaacaattga |
32189702 |
T |
 |
Q |
101 |
ttgcacgataacgttagttacaaaggatgccttttgtatttatacacccgacaatttcgtcaaccaaattgtgaattaacaaagctcattgaatctataa |
200 |
Q |
|
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
T |
32189703 |
ttgcacgataacgttagttacacaggatgccttttgtatttatacacccgacaatttcgtcaaccaaattgtgaattaacaaagctcgttgaatctataa |
32189802 |
T |
 |
Q |
201 |
gaagtcactaaattataattgaagt |
225 |
Q |
|
|
||||||||||||||||||||||||| |
|
|
T |
32189803 |
gaagtcactaaattataattgaagt |
32189827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University