View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10049A_low_338 (Length: 230)
Name: NF10049A_low_338
Description: NF10049A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10049A_low_338 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 34; Significance: 0.0000000003; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 166 - 215
Target Start/End: Complemental strand, 11421049 - 11421001
Alignment:
| Q |
166 |
cgtgtatgaaaggctctttagtaaactttcattttcccacgatcttgttg |
215 |
Q |
| |
|
||||||| |||||||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
11421049 |
cgtgtataaaaggctctttagtaaac-ttcattttcccatgatcttgttg |
11421001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 66 - 95
Target Start/End: Complemental strand, 11421173 - 11421144
Alignment:
| Q |
66 |
gcctcggccaagtaagtgaatgtattacaa |
95 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
11421173 |
gcctcggccaagtaagtgaatgtattacaa |
11421144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University