View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10049A_low_355 (Length: 229)
Name: NF10049A_low_355
Description: NF10049A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10049A_low_355 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 123; Significance: 2e-63; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 7 - 145
Target Start/End: Complemental strand, 7127758 - 7127620
Alignment:
| Q |
7 |
acacgagccttcacacgtgtcggatacaacgtgtcaagaacaattagagttctctgaaaatcacagtgttgatgttgatcttgtggattctacaattgtt |
106 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
7127758 |
acacgagccttcacacgtgttggatacaacgtgtcaagaacaattagtgttctctgaaaatcacagtgttgatgttgatcttgtggattctgcaattgta |
7127659 |
T |
|
| Q |
107 |
gccactgcaacttcttcgtcgctgtccctgaatttcaac |
145 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7127658 |
gccactgcaacttcttcgtcgctgtccctgaatttcaac |
7127620 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University