View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10049A_low_359 (Length: 229)
Name: NF10049A_low_359
Description: NF10049A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10049A_low_359 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 229
Target Start/End: Original strand, 43703077 - 43703305
Alignment:
| Q |
1 |
tcaacagttacacttatgcagagaaatttacaccaaagtttcatgttagacttgctttttgagcaaaataaaacatactttatttcactacaaagtttaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43703077 |
tcaacagttacacttatgcagagaaatttacaccaaagtttcatgttagacttgctttttgagcaaaataaaacatactttatttcactacaaagtttaa |
43703176 |
T |
|
| Q |
101 |
acttggttttattcacattacttttatcaccaacatgagttggtccgacttgaaggggctcggatcccttgagcaagaggtataggattcaaaatttagt |
200 |
Q |
| |
|
|||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43703177 |
actttgttttattcacattacttttatcgccaacatgagttggtccgacttgaaggggctcggatcccttgagcaagaggtataggattcaaaatttagt |
43703276 |
T |
|
| Q |
201 |
ttttgtgaatcacgcaaattctgttggga |
229 |
Q |
| |
|
|||||||||||| |||||||||||||||| |
|
|
| T |
43703277 |
ttttgtgaatcaagcaaattctgttggga |
43703305 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University