View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10049A_low_361 (Length: 228)
Name: NF10049A_low_361
Description: NF10049A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10049A_low_361 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 16 - 208
Target Start/End: Original strand, 3675343 - 3675535
Alignment:
| Q |
16 |
aacaatatcaatcacagctgcagttgtaggtcgaaatatattattcccagtgataagttcatgaatttgacgatacacttggcttcctgtgtatatactt |
115 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3675343 |
aacaaaatcaatcacagctgcagttgtaggtcgaaatatattattcccagtgataagttcatgaatttgacgatacacttggcttcctgtgtatatactt |
3675442 |
T |
|
| Q |
116 |
gtaaaaaatgctaccacaagcaaatacctaagattnnnnnnnttattaattaaagttccatacaaattaaattttgacaaaaacccatcatat |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3675443 |
gtaaaaaatgctaccacaagcaaatacctaagattaaaaaaattattaattaaagttccatacaaattaaattttgacaaaaacccatcatat |
3675535 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University