View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10049A_low_372 (Length: 226)
Name: NF10049A_low_372
Description: NF10049A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10049A_low_372 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 139; Significance: 7e-73; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 18 - 202
Target Start/End: Complemental strand, 17812148 - 17811965
Alignment:
| Q |
18 |
ttcctcaccattaatccgagagctccttaccaccccgaggg-ttactcatgtccgtaccccaggcatagatggctggagaagtgaggggttcaagaaaga |
116 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
17812148 |
ttcctcaccattaatccgagagctcctcaccaccccgaggggttactcatgtccgtaccccaggaatagatggctggagaagtgaggggttcaagaaaga |
17812049 |
T |
 |
| Q |
117 |
gagtgtcggagcgcgtgcagtgcaggtacaccatcccccttccagtggagaagaacctgcaacagacgactcaacggaaccatgct |
202 |
Q |
| |
|
| |||| |||| | |||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17812048 |
g--tgtcagagcacatgcagtgcaggtacaccaccccccttccggtggagaagaacctgcaacagacgactcaacggaaccatgct |
17811965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University