View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10049A_low_375 (Length: 225)
Name: NF10049A_low_375
Description: NF10049A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10049A_low_375 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 88; Significance: 2e-42; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 15 - 224
Target Start/End: Original strand, 23840408 - 23840619
Alignment:
Q |
15 |
aagaaacaaagatacggagcacaggtttaaataaagatttatgacagctatgtaggctgtgacataacggttgcatcagttatatctaatcgcgattcta |
114 |
Q |
|
|
||||||||| ||| |||||| |||||||||||||| || ||||||||| ||| |||||||||| ||||||||||||||||||||| |||||||||| |
|
|
T |
23840408 |
aagaaacaacaatagggagcaacggtttaaataaagacttgcgacagctatctagcttgtgacataatggttgcatcagttatatctaaccgcgattcta |
23840507 |
T |
 |
Q |
115 |
cacaatattaaggatcgcaacacaaagacaacccgttatacgaagtacaaagactaaaaaagacact--gnnnnnnngttaccttgtcatcgatgaattt |
212 |
Q |
|
|
| ||||||||||||||||||||| |||||||| |||||| |||||||| | ||||||||| | ||| ||||||||||||||||||||||| |
|
|
T |
23840508 |
cgcaatattaaggatcgcaacacgaagacaacgtgttataggaagtacatatactaaaaaaaatactaaaagaagaagttaccttgtcatcgatgaattt |
23840607 |
T |
 |
Q |
213 |
cgaccaaaatcg |
224 |
Q |
|
|
|||||||||||| |
|
|
T |
23840608 |
cgaccaaaatcg |
23840619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 191 - 224
Target Start/End: Original strand, 23861237 - 23861270
Alignment:
Q |
191 |
ttaccttgtcatcgatgaatttcgaccaaaatcg |
224 |
Q |
|
|
|||||||||||||||||||||||||||||||||| |
|
|
T |
23861237 |
ttaccttgtcatcgatgaatttcgaccaaaatcg |
23861270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 190 - 224
Target Start/End: Original strand, 23844033 - 23844067
Alignment:
Q |
190 |
gttaccttgtcatcgatgaatttcgaccaaaatcg |
224 |
Q |
|
|
||||||||||||||||||||||| ||||||||||| |
|
|
T |
23844033 |
gttaccttgtcatcgatgaattttgaccaaaatcg |
23844067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University