View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10049A_low_378 (Length: 225)
Name: NF10049A_low_378
Description: NF10049A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10049A_low_378 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 11 - 217
Target Start/End: Complemental strand, 30878021 - 30877815
Alignment:
| Q |
11 |
tcatcatctactgtcacttgttcactgacactgtcattttcatcactatcacactccaaaacaactctgacacagaacaaacacctctccttattccatt |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30878021 |
tcatcatctactgtcacttgttcactgacactgtcattttcatcactatcacactccaaaacaactctgacacagaacaaacacctctccttattccatt |
30877922 |
T |
|
| Q |
111 |
gtttccaaggttgtctcctgtgtttggtccccacaaacaactctcctttttcatttctcttttcactttgctatggaaatggaaggttatgatattgttg |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
30877921 |
gtttccaaggttgtctcctgtgtttggtccccacaaacaactctcctttttcatttctcttttcactttgctatggaaatggaaggttatgatatatttg |
30877822 |
T |
|
| Q |
211 |
gagatgc |
217 |
Q |
| |
|
||||||| |
|
|
| T |
30877821 |
gagatgc |
30877815 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University