View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10049A_low_384 (Length: 222)
Name: NF10049A_low_384
Description: NF10049A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10049A_low_384 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 15 - 222
Target Start/End: Complemental strand, 9539217 - 9539009
Alignment:
| Q |
15 |
aagaatatgacacttgaaatgnnnnnnntaacacaaggaaatctaaatgtgagtttctaatcttatgcatgagttnnnnnnnn-tagtatatttaaaaaa |
113 |
Q |
| |
|
||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
9539217 |
aagaaaatgacacttgaaatgaaaaaaataacacaaggaaatctaaatgtgagtttctaatcttatgcatgagttaaaaaaaaatagtatatttaaaaaa |
9539118 |
T |
 |
| Q |
114 |
tcatatttgaacttagttcataatttaaataattgaactatgttccaacaacattgatatatcactgaaaaatttgtgtgagaagaatctgcaactataa |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||| |||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
9539117 |
tcatatttgaacttagttcataatttaaataattcaacaatgttccaacaaaattgatatatcattgaaaaatttgtgtgagaagaatctgcaactataa |
9539018 |
T |
 |
| Q |
214 |
gctgatgca |
222 |
Q |
| |
|
|||||||| |
|
|
| T |
9539017 |
actgatgca |
9539009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University