View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10049A_low_389 (Length: 221)
Name: NF10049A_low_389
Description: NF10049A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10049A_low_389 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 16 - 221
Target Start/End: Original strand, 34570946 - 34571151
Alignment:
| Q |
16 |
aacatcctggtcaaatggaccgtcaaaatcaaaaacttccacatacaaaactgatggtggttcttccatagcatcaaactctaatatctctgcatattag |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34570946 |
aacatcctggtcaaatggaccgtcaaaatcaaaaacttccacatacaaaactgatggtggttcttccatagcatcaaactctaatatctctgcatattag |
34571045 |
T |
|
| Q |
116 |
tatataaaaccaatacagaatataagtaaataaacattcaaattgaaacaannnnnnnagcaattaagtggcaagtcagaaggacaaaccattccattga |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34571046 |
tatataaaaccaatacagaatataagtaaagaaacattcaaattgaaacaatttttttagcaattaagtggcaagtcagaaggacaaaccattccattga |
34571145 |
T |
|
| Q |
216 |
ggatct |
221 |
Q |
| |
|
|||||| |
|
|
| T |
34571146 |
ggatct |
34571151 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University