View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10049A_low_394 (Length: 220)
Name: NF10049A_low_394
Description: NF10049A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10049A_low_394 |
 | |
|
| [»] scaffold0057 (2 HSPs) |
| | |
|
Alignment Details
Target: chr1 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 22 - 208
Target Start/End: Original strand, 46844530 - 46844716
Alignment:
| Q |
22 |
ccgtgtctgtcttattacatcaaaggaaagtatgatttgctaatttgtgtccgattagaattagaacgattccttgaaggaatgatagtgaataccatga |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
46844530 |
ccgtgtctgtcttattacatcaaaggaaagtataatttgctaatttgtgtccgattagaattagaccgattccttgaaggaatgatagtgaataccatga |
46844629 |
T |
|
| Q |
122 |
gatcttgaacctagttgcattattgcattgcaggggtgagatggcattttgcagccatgaatgccgtgaccagaggatattgttgga |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
46844630 |
gatcttgaacctagttgcattattgcattgcaggggtgagatggcattttgcagccatgaatgccgtgaccagaggatgttgttgga |
46844716 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0057 (Bit Score: 35; Significance: 0.00000000008; HSPs: 2)
Name: scaffold0057
Description:
Target: scaffold0057; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 154 - 208
Target Start/End: Complemental strand, 48986 - 48932
Alignment:
| Q |
154 |
ggggtgagatggcattttgcagccatgaatgccgtgaccagaggatattgttgga |
208 |
Q |
| |
|
||||||||||||||||||||| || |||||||||| ||||||||| | ||||||| |
|
|
| T |
48986 |
ggggtgagatggcattttgcaaccctgaatgccgtaaccagaggaaactgttgga |
48932 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0057; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 152 - 208
Target Start/End: Complemental strand, 28099 - 28043
Alignment:
| Q |
152 |
caggggtgagatggcattttgcagccatgaatgccgtgaccagaggatattgttgga |
208 |
Q |
| |
|
|||| |||||||||||||||||| || |||||| ||| ||||||||| | ||||||| |
|
|
| T |
28099 |
caggcgtgagatggcattttgcaaccttgaatgtcgtaaccagaggaaactgttgga |
28043 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University