View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10049A_low_396 (Length: 220)
Name: NF10049A_low_396
Description: NF10049A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10049A_low_396 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 20 - 220
Target Start/End: Complemental strand, 47584080 - 47583880
Alignment:
| Q |
20 |
gaatcttgttgaaacctatgaaaggttctcggagaaatggcgattgattattagaagagtaacatgcacgtgtgcaggcagtgaatcattctactgtgtg |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
47584080 |
gaatcttgttgaaacctatgaaaggttctcggagaaatggcgattgattattagaagagtaacatgcacgtgtgcaggcagtgaatcattctagtgtgtg |
47583981 |
T |
 |
| Q |
120 |
ctcttggagtggagccatttgtaagtctagggaaactaccaaaaggcttagcgttgatttggcacaccattttgtggtcaatatagaatgctagaaatga |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47583980 |
ctcttggagtggagccatttgtaagtctagggaaactaccaaaaggcttagcgttgatttggcacaccattttgtggtcaatatagaatgctagaaatga |
47583881 |
T |
 |
| Q |
220 |
c |
220 |
Q |
| |
|
| |
|
|
| T |
47583880 |
c |
47583880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University