View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10049A_low_399 (Length: 218)
Name: NF10049A_low_399
Description: NF10049A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10049A_low_399 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 15 - 218
Target Start/End: Complemental strand, 46869531 - 46869328
Alignment:
| Q |
15 |
ataatttactatacttattgcattaaaatgccttcatgatgctttatgataagctttcatcgtatttttcgggaggatgtaaataacttaccatactttc |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46869531 |
ataatttactatacttattgcattaaaatgccttcatgatgctttatgataagctttcatcgtatttttcgggaggatgtaaataacttaccatactttc |
46869432 |
T |
|
| Q |
115 |
ttgcattaaatttaaaatttaacaactgtatcatagaaaagggaataatatcatatctacatgcatgagaaaacccagcccccgatatatcacagatgca |
214 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| | |
|
|
| T |
46869431 |
tagcattaaatttaaaatttaacaactgtatcatagaaaagggaataatatcatatctacatgcatgagaaaaccaagcccccgatatatcacagatgta |
46869332 |
T |
|
| Q |
215 |
aatg |
218 |
Q |
| |
|
|||| |
|
|
| T |
46869331 |
aatg |
46869328 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University