View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10049A_low_403 (Length: 217)
Name: NF10049A_low_403
Description: NF10049A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10049A_low_403 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 35 - 199
Target Start/End: Original strand, 47436714 - 47436878
Alignment:
| Q |
35 |
agaccagaggaaatacacatttatttttaagggttcaccatgcatgtaagatctcacatttcaatagggttttcataatcctttaccttaatttggttgc |
134 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47436714 |
agaccagaggaaatacacatttatttttaagggttcaccgtgcatgtaagatctcaaatttcaatagggttttcataatcctttaccttaatttggttgc |
47436813 |
T |
|
| Q |
135 |
gcttgttttgaaaccagaacttgatttgcgtcgatgtaagacctagctcacaactcaattgtttc |
199 |
Q |
| |
|
|||||||||||||| ||||||||||||||| | |||||| |||||||||||||||||||||||| |
|
|
| T |
47436814 |
gcttgttttgaaactagaacttgatttgcgcaggtgtaaggcctagctcacaactcaattgtttc |
47436878 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University