View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10049A_low_415 (Length: 212)
Name: NF10049A_low_415
Description: NF10049A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10049A_low_415 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 7 - 212
Target Start/End: Complemental strand, 38323091 - 38322886
Alignment:
| Q |
7 |
aacatagtctaccatttctgatgaagatattaatgccaatttttcctccttgtttcgaaaactagaatttaaagtagaaagtagcttaggaaaatctacc |
106 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38323091 |
aacatagtctatcatttctgatgaagatattaatgccaatttttcctccttgtttcgaaaactagaatttaaagtagaaagtagcttaggaaaatctacc |
38322992 |
T |
 |
| Q |
107 |
tctactactttctctactttactttggataggatatctcatgatatattgaggatattgctgaacaattgacacaattgtagaagaatcatcgatgcttg |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38322991 |
tctactactttctctactttactttggataggatatctcatgatatattgaggatattgctgaacaattgacacaattgtagaagaatcatcgatgcttg |
38322892 |
T |
 |
| Q |
207 |
atttgg |
212 |
Q |
| |
|
|||||| |
|
|
| T |
38322891 |
atttgg |
38322886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University