View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10049A_low_421 (Length: 208)
Name: NF10049A_low_421
Description: NF10049A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10049A_low_421 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 146; Significance: 4e-77; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 146; E-Value: 4e-77
Query Start/End: Original strand, 12 - 208
Target Start/End: Complemental strand, 15250437 - 15250240
Alignment:
| Q |
12 |
gagtttggtgttgttttaactttttagtgcatcatgctaacagtaaataa----tattaactatcatcactttgaaacaaaatagaacccatgatacatt |
107 |
Q |
| |
|
|||||| | ||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||| ||||| |
|
|
| T |
15250437 |
gagtttagcgttgttttaactttttagtgcatcatgctaacagtaaataaataatattaactatca---ctttgaaacaaaatagaacccatgacacatt |
15250341 |
T |
|
| Q |
108 |
tattaaattaaagtcattctgaccaatatcatctacaaccacatgtttcaaagaccacagaatccaccaggtcccccaaacaacacaacacgttgcaaat |
207 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
15250340 |
tattaaattaaagtaattctgaccaatatcatctacaaccacatgttttaaagaccacagaatccaccaggtccaccaaacaacacaacacgttgcaaat |
15250241 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University