View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10049A_low_422 (Length: 207)
Name: NF10049A_low_422
Description: NF10049A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10049A_low_422 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 53; Significance: 1e-21; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 20 - 80
Target Start/End: Complemental strand, 32124974 - 32124914
Alignment:
| Q |
20 |
tgaatacaattggtgacgatgattaagagatgattgcttggggacgaaaagtctaactttt |
80 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
32124974 |
tgaatgcaattggtgacgatgattaagagatgattgcttggggacgaaaaatctaactttt |
32124914 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University