View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10049A_low_430 (Length: 203)
Name: NF10049A_low_430
Description: NF10049A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10049A_low_430 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 110; Significance: 1e-55; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 20 - 133
Target Start/End: Original strand, 10368671 - 10368784
Alignment:
Q |
20 |
atcatctccttcatcacaacccgtgctgtagtggtatgaaaattgaaaaggacggcaagaagaagaaggaagttactatttctaggtatgggtttgcatt |
119 |
Q |
|
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
10368671 |
atcatctccttcatcacaacccgtactgtagtggtatgaaaattgaaaaggacggcaagaagaagaaggaagttactatttctaggtatgggtttgcatt |
10368770 |
T |
 |
Q |
120 |
tcgatctcacccct |
133 |
Q |
|
|
|||||||||||||| |
|
|
T |
10368771 |
tcgatctcacccct |
10368784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 147 - 178
Target Start/End: Original strand, 10368838 - 10368869
Alignment:
Q |
147 |
gcgtgtgtgtgtcttaaggaacaattgtggag |
178 |
Q |
|
|
|||||||||||||||||||||||||||||||| |
|
|
T |
10368838 |
gcgtgtgtgtgtcttaaggaacaattgtggag |
10368869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 49; Significance: 3e-19; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 61 - 129
Target Start/End: Original strand, 11659585 - 11659653
Alignment:
Q |
61 |
attgaaaaggacggcaagaagaagaaggaagttactatttctaggtatgggtttgcatttcgatctcac |
129 |
Q |
|
|
|||||||||||| ||||||| |||||||| | ||||||||| ||||||||||||||||||||||||||| |
|
|
T |
11659585 |
attgaaaaggacagcaagaacaagaaggaggctactatttcaaggtatgggtttgcatttcgatctcac |
11659653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 61 - 129
Target Start/End: Original strand, 11668754 - 11668822
Alignment:
Q |
61 |
attgaaaaggacggcaagaagaagaaggaagttactatttctaggtatgggtttgcatttcgatctcac |
129 |
Q |
|
|
|||||||||||| |||| ||||||||||| | ||||||||| |||||| |||||||||||||||||||| |
|
|
T |
11668754 |
attgaaaaggacagcaaaaagaagaaggaggctactatttcaaggtatcggtttgcatttcgatctcac |
11668822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 40; Significance: 0.00000000000007; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 24 - 99
Target Start/End: Original strand, 53239215 - 53239290
Alignment:
Q |
24 |
tctccttcatcacaacccgtgctgtagtggtatgaaaattgaaaaggacggcaagaagaagaaggaagttactatt |
99 |
Q |
|
|
|||||||||| ||||| | |||| |||||| ||||||||||||||||| ||||||||||||| |||| ||||||| |
|
|
T |
53239215 |
tctccttcattgcaaccagcgctgcagtggtctgaaaattgaaaaggacagcaagaagaagaaagaagctactatt |
53239290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 40; Significance: 0.00000000000007; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 24 - 99
Target Start/End: Original strand, 2170330 - 2170405
Alignment:
Q |
24 |
tctccttcatcacaacccgtgctgtagtggtatgaaaattgaaaaggacggcaagaagaagaaggaagttactatt |
99 |
Q |
|
|
|||||||||| ||||| | |||| |||||| ||||||||||||||||| ||||||||||||| |||| ||||||| |
|
|
T |
2170330 |
tctccttcattgcaaccagcgctgcagtggtctgaaaattgaaaaggacagcaagaagaagaaagaagctactatt |
2170405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University