View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10049A_low_432 (Length: 203)
Name: NF10049A_low_432
Description: NF10049A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10049A_low_432 |
 | |
|
| [»] chr3 (2 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 194; Significance: 1e-106; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 194; E-Value: 1e-106
Query Start/End: Original strand, 2 - 203
Target Start/End: Original strand, 19772221 - 19772422
Alignment:
| Q |
2 |
gtaaaatcgagtaggttacagttgtccgtgaaatttgagaagatgtagctcttgtatgataaaaaattccccttatttgttcacttaaaagaagggtttc |
101 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19772221 |
gtaaaatcgagtaggttacagttgtctgtgaaatttgagaagatgtagctcttgtatgataaaaaattccccttatttgttcacttaaaagaagggtttc |
19772320 |
T |
|
| Q |
102 |
attaaaataacctatgagcatctaactagagataggtaatagtatgactgagggtgaccaaaacaacatacccaaagccaatcaacaacctcccatccct |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19772321 |
attaaaataacctatgagcatctaactagagataggtaatagtatgactgagagtgaccaaaacaacatacccaaagccaatcaacaacctcccatccct |
19772420 |
T |
|
| Q |
202 |
ct |
203 |
Q |
| |
|
|| |
|
|
| T |
19772421 |
ct |
19772422 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 3 - 37
Target Start/End: Complemental strand, 18355405 - 18355371
Alignment:
| Q |
3 |
taaaatcgagtaggttacagttgtccgtgaaattt |
37 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
18355405 |
taaaatcgagtaggttacagttgtccgtgaaattt |
18355371 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University