View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10049A_low_434 (Length: 202)
Name: NF10049A_low_434
Description: NF10049A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10049A_low_434 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 22 - 178
Target Start/End: Complemental strand, 36930715 - 36930559
Alignment:
| Q |
22 |
ggttgctccacaccacacagctattgttgtaccttgttaatgttgttttccgtgattcagccatgcacgcattgaaggtccaggcatagcagctatccca |
121 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36930715 |
ggttgccccacaccacacagctattgttgtaccttgttaatgttgttttccgtcattcagccatgcacgcattgaaggtccaggcatagcagctatccca |
36930616 |
T |
|
| Q |
122 |
ttcttatggaattattttgatgtgaaataatatgttattcgatttttatatgtattt |
178 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36930615 |
ttcttatgaaattattttgatgtgaaataatatgttattcgatttttatatgtattt |
36930559 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University