View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10049A_low_71 (Length: 364)
Name: NF10049A_low_71
Description: NF10049A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10049A_low_71 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 21 - 64
Target Start/End: Original strand, 2330844 - 2330887
Alignment:
Q |
21 |
actcatgagtcaagaactcaaagcattattgcatattgtgaacc |
64 |
Q |
|
|
|||||||||||| ||||||||||||||||||||||||||||||| |
|
|
T |
2330844 |
actcatgagtcatgaactcaaagcattattgcatattgtgaacc |
2330887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 21 - 102
Target Start/End: Complemental strand, 1549827 - 1549746
Alignment:
Q |
21 |
actcatgagtcaagaactcaaagcattattgcatattgtgaacctctgaaagttatacttccaaattaattaagttgagtgt |
102 |
Q |
|
|
|||| ||||||||||||||||||| ||||| |||||||| |||| |||||| | ||||| ||||||||||||||||||| |
|
|
T |
1549827 |
actcttgagtcaagaactcaaagcgttatttcatattgtaaaccattgaaagaaaaacttcggaattaattaagttgagtgt |
1549746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 21 - 64
Target Start/End: Original strand, 2338700 - 2338743
Alignment:
Q |
21 |
actcatgagtcaagaactcaaagcattattgcatattgtgaacc |
64 |
Q |
|
|
|||||||||||||||| ||||||||||||| ||||||||||||| |
|
|
T |
2338700 |
actcatgagtcaagaattcaaagcattattccatattgtgaacc |
2338743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University