View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10049A_low_73 (Length: 362)
Name: NF10049A_low_73
Description: NF10049A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10049A_low_73 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 338; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 338; E-Value: 0
Query Start/End: Original strand, 7 - 356
Target Start/End: Complemental strand, 51873981 - 51873632
Alignment:
Q |
7 |
tttggagttggccatctttgaagttcattttgatcttgaacttcatcatgaggagggtcatttatgagtagtttgggatcagaagttatgaggttggttt |
106 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
T |
51873981 |
tttggagttggccatctttgaagttcattttgatcttgaacttcatcatgaggagggtcatttatgagtagtttaggatcagaagttatgaggttggttt |
51873882 |
T |
 |
Q |
107 |
gtgtgggacagagaaatggggatggcttaggtttacacatatctcactagcaagtagttttggatatgtacaaaggatagaatatacaagagctaccact |
206 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
51873881 |
gtgtgggacagagaaatggggatggcttaggtttacacatatctcactagcaagtagttttggatatgtacaaaggatagaatatacaagagctaccact |
51873782 |
T |
 |
Q |
207 |
gctcttgcttctagcttaggcttagtgatcgtggatggattgtgtttgaagctgtttgagaagatgtaagaggtttgtgtattttgtatgggaggaagat |
306 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
51873781 |
gctcttgcttctagcttaggcttagtgatcgtggatggactgtgtttgaagctgtttgagaagatgtaagaggtttgtgtattttgtatgggaggaagat |
51873682 |
T |
 |
Q |
307 |
gatgaaggtgagtgtgtgtttttatgcatgaagaaaggtttgggccctac |
356 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
T |
51873681 |
gatgaaggtgagtgtgtgtttttatgcatgaagaaaggcttgggccctac |
51873632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University