View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10049A_low_77 (Length: 360)
Name: NF10049A_low_77
Description: NF10049A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10049A_low_77 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 323; Significance: 0; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 323; E-Value: 0
Query Start/End: Original strand, 22 - 356
Target Start/End: Original strand, 36170376 - 36170710
Alignment:
| Q |
22 |
gttggtgttgaggaagttaagagatttatggttgaggaggatgcggtgtcgacttttatcaggctagtgaaatcaaaggaggaagcaattcaggtgaatt |
121 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36170376 |
gttggtgttgaggaagttaagagattcatggttgaggaggatgcggtgtcgacttttatcaggctagtgaaatcaaaggaggaagcaattcaggtgaatt |
36170475 |
T |
 |
| Q |
122 |
caatagggttcattcagaatattgcctttggagatgagttggttaggcaaacggtgattagagaaggcggaatccgtgctttgttacgtgttttagatcc |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36170476 |
caatagggttcattcagaatattgcctttggagatgagttggttaggcaaatggtgattagagaaggcggaatccgtgctttgttacgtgttttagatcc |
36170575 |
T |
 |
| Q |
222 |
gaaatggtcatattcttcaaaaacaaaggaaataacaatgagggctattgaaagtttgtgttttacttcatctagctctgtaagtattttaatgagttat |
321 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36170576 |
gaaatggtcatattcttcaaaaacaaaggaaataacaatgagggctattgaaagtttgtgttttacttcatctagctctgtaagtattttaatgagttat |
36170675 |
T |
 |
| Q |
322 |
ggttttgtggatcagttgctatattttgttcgaca |
356 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||| |
|
|
| T |
36170676 |
ggttttgtggatcagttgctatattatgttcgaca |
36170710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 294 - 356
Target Start/End: Complemental strand, 1286394 - 1286332
Alignment:
| Q |
294 |
tagctctgtaagtattttaatgagttatggttttgtggatcagttgctatattttgttcgaca |
356 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
1286394 |
tagctctgtaagtattttaatgagttatggttttgtggatcagttgctatattatgttcgaca |
1286332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University