View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10049A_low_84 (Length: 350)
Name: NF10049A_low_84
Description: NF10049A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10049A_low_84 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 128; Significance: 4e-66; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 128; E-Value: 4e-66
Query Start/End: Original strand, 116 - 243
Target Start/End: Original strand, 28439127 - 28439254
Alignment:
| Q |
116 |
atatagcccatgtaccatttgcaggaatgataatactccaatctaattgtctacataacagaacatgaacttgtccagtcaatcgatatcttgaaattta |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28439127 |
atatagcccatgtaccatttgcaggaatgataatactccaatctaattgtctacataacagaacatgaacttgtccagtcaatcgatatcttgaaattta |
28439226 |
T |
|
| Q |
216 |
atgtctaacgttgtgtgtgtgaaatatt |
243 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
28439227 |
atgtctaacgttgtgtgtgtgaaatatt |
28439254 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University