View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10049_high_25 (Length: 239)
Name: NF10049_high_25
Description: NF10049
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10049_high_25 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 181 - 224
Target Start/End: Complemental strand, 2330887 - 2330844
Alignment:
| Q |
181 |
ggttcacaatatgcaataatgctttgagttcttgactcatgagt |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
2330887 |
ggttcacaatatgcaataatgctttgagttcatgactcatgagt |
2330844 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 143 - 224
Target Start/End: Original strand, 1549746 - 1549827
Alignment:
| Q |
143 |
acactcaacttaattaatttggaagtataactttcagaggttcacaatatgcaataatgctttgagttcttgactcatgagt |
224 |
Q |
| |
|
||||||||||||||||||| ||||| | |||||| |||| |||||||| ||||| ||||||||||||||||||| |||| |
|
|
| T |
1549746 |
acactcaacttaattaattccgaagtttttctttcaatggtttacaatatgaaataacgctttgagttcttgactcaagagt |
1549827 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 181 - 224
Target Start/End: Complemental strand, 2338743 - 2338700
Alignment:
| Q |
181 |
ggttcacaatatgcaataatgctttgagttcttgactcatgagt |
224 |
Q |
| |
|
||||||||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
2338743 |
ggttcacaatatggaataatgctttgaattcttgactcatgagt |
2338700 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University