View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10049_low_31 (Length: 250)
Name: NF10049_low_31
Description: NF10049
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10049_low_31 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 237; Significance: 1e-131; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 1 - 237
Target Start/End: Original strand, 36563808 - 36564044
Alignment:
| Q |
1 |
ttgcgcattaatcacatttaactaaccttgaacaactactatatatacatatattaaaccttctgtgtaagccagaatagcttctccaaaagagttaaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36563808 |
ttgcgcattaatcacatttaactaaccttgaacaactactatatatacatatattaaaccttctgtgtaagccagaatagcttctccaaaagagttaaaa |
36563907 |
T |
 |
| Q |
101 |
taaaaatagtacataatattattacttcattattatcatgaggcttatatgcatatgcatagcatggttaatattgataacccaaattatcatggtgact |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36563908 |
taaaaatagtacataatattattacttcattattatcatgaggcttatatgcatatgcatagcatggttaatattgataacccaaattatcatggtgact |
36564007 |
T |
 |
| Q |
201 |
tgcaagactaaaaatcatgtaccagcagtaattgtct |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36564008 |
tgcaagactaaaaatcatgtaccagcagtaattgtct |
36564044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 152 - 235
Target Start/End: Original strand, 36576588 - 36576671
Alignment:
| Q |
152 |
catatgcatagcatggttaatattgataacccaaattatcatggtgacttgcaagactaaaaatcatgtaccagcagtaattgt |
235 |
Q |
| |
|
||||||||| | |||| ||||||||||||| ||||| ||||||||||||||||| | | ||||| ||||||||||||||||||| |
|
|
| T |
36576588 |
catatgcatcgtatggctaatattgataactcaaatgatcatggtgacttgcaataatgaaaattatgtaccagcagtaattgt |
36576671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University