View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10049_low_32 (Length: 250)
Name: NF10049_low_32
Description: NF10049
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10049_low_32 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 242
Target Start/End: Original strand, 22348013 - 22348257
Alignment:
| Q |
1 |
ctattatctttatcataaactgcacaggagttaaacttgcaactgacagccattagtttcatcatacagtacatagatatgtaaatacatctggcagcct |
100 |
Q |
| |
|
||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22348013 |
ctattatctttattataaactgtacaggagttaaacttgcaactgacagccattagtttcatcatacagtacatagatatgtaaatacatctggcagcca |
22348112 |
T |
|
| Q |
101 |
ttaccatatt---atagcaccaacattattaactttgcattaacataatcaaccctagtagtaggatcaattctacgctcatttgcaacgaaaattgcgt |
197 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
22348113 |
ttaccatatatcgatagcaccaacattattaactttgcattaacataatcaaccctagtagtaggatcaattctacgctcatttgcaatgaaaattgcgt |
22348212 |
T |
|
| Q |
198 |
ttctgatggttcctggcgcctgaactccagcgctggctctctgct |
242 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
22348213 |
ttctgatggttcctggcgcctgaactccagcactggctctctgct |
22348257 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University