View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10049_low_33 (Length: 250)
Name: NF10049_low_33
Description: NF10049
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10049_low_33 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 8 - 165
Target Start/End: Original strand, 8931365 - 8931526
Alignment:
| Q |
8 |
gtaagagcatatatttttcttatctact----taaatcatgtgagtgatgataaaatcaacaatcatgcatggctattttttcacattgcgacaaattaa |
103 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8931365 |
gtaagagcatatatttttcttatctacttacttaaatcatgtgagtgatgataaaatcaacaatcatgcatggctattttttcacattgcgacaaattaa |
8931464 |
T |
 |
| Q |
104 |
ccagtgtttatcaatcatcatactaaatgcttctccactcaacgagagaaacaattcattcc |
165 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8931465 |
ccagtgtttatcaatcatcatactaaatgcttctccactcaacgagagaaacaattcattcc |
8931526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University