View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10049_low_35 (Length: 246)
Name: NF10049_low_35
Description: NF10049
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10049_low_35 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 239
Target Start/End: Original strand, 1242154 - 1242392
Alignment:
| Q |
1 |
aaaaagtaggaaattaatgcagcattcgtgtgacaaagttgtaacttgtgtagattgtgacactagtaccatatcgagcagaagcaggtggattgaatat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| | |||||||||||||||| |
|
|
| T |
1242154 |
aaaaagtaggaaattaatgcagcattcgtgtgacaaagttgtaacttgtgtagattgtgacactagtaccagatcgagcaggaccaggtggattgaatat |
1242253 |
T |
|
| Q |
101 |
acagatgggaagtttggctctatcactagctagttagaaattgagtataactcttggtctctcacacaaccataatttaccctttttatattatagtcac |
200 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1242254 |
acagatgggaagtttggctctatcacgagctaggtagaaattgagtataacacttggtctctcacacaaccataatttaccctttttatattatagtcac |
1242353 |
T |
|
| Q |
201 |
gtttttgggttgcttttttcatggttttagcttcctttg |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
1242354 |
gtttttgggttgcttttttcatggttttagcttcttttg |
1242392 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University