View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10049_low_39 (Length: 241)
Name: NF10049_low_39
Description: NF10049
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10049_low_39 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 123; Significance: 3e-63; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 14 - 144
Target Start/End: Complemental strand, 3889425 - 3889295
Alignment:
| Q |
14 |
aagtagaaatatttatttatttattttgattttaaagggactagtggcaaaactctcacacagtggataattgcatatttaaatttggattttagtatat |
113 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3889425 |
aagtagaaatatttatttatttatttttattttaaagggactagtggcaaaactctcacgcagtggataattgcatatttaaatttggattttagtatat |
3889326 |
T |
 |
| Q |
114 |
ccattgttcatgctacctataacattttgtc |
144 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
3889325 |
ccattgttcatgctacctataacattttgtc |
3889295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University