View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10049_low_40 (Length: 240)
Name: NF10049_low_40
Description: NF10049
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10049_low_40 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 85; Significance: 1e-40; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 23 - 209
Target Start/End: Complemental strand, 23840619 - 23840431
Alignment:
| Q |
23 |
cgattttggtcgaaattcatcgatgacaaggtaacnnnnnnnc--agtgtcttttttagtctttgtacttcgtataacgggttgtctttgtgttgcgatc |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||| | ||||||||| | |||||||| |||||| |||||||| ||||||||||| |
|
|
| T |
23840619 |
cgattttggtcgaaattcatcgatgacaaggtaacttcttcttttagtattttttttagtatatgtacttcctataacacgttgtcttcgtgttgcgatc |
23840520 |
T |
|
| Q |
121 |
cttaatattgtgtagaatcgcgattagatataactgatgcaaccgttatgtcacagcctacatagctgtcataaatctttatttaaacc |
209 |
Q |
| |
|
|||||||||| ||||||||||| ||||||||||||||||||||| |||||||||| ||| ||||||||| || |||||||||||||| |
|
|
| T |
23840519 |
cttaatattgcgtagaatcgcggttagatataactgatgcaaccattatgtcacaagctagatagctgtcgcaagtctttatttaaacc |
23840431 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 23 - 56
Target Start/End: Complemental strand, 23861270 - 23861237
Alignment:
| Q |
23 |
cgattttggtcgaaattcatcgatgacaaggtaa |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
23861270 |
cgattttggtcgaaattcatcgatgacaaggtaa |
23861237 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 23 - 57
Target Start/End: Complemental strand, 23844067 - 23844033
Alignment:
| Q |
23 |
cgattttggtcgaaattcatcgatgacaaggtaac |
57 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
23844067 |
cgattttggtcaaaattcatcgatgacaaggtaac |
23844033 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University