View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10049_low_42 (Length: 239)

Name: NF10049_low_42
Description: NF10049
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10049_low_42
NF10049_low_42
[»] chr7 (3 HSPs)
chr7 (181-224)||(2330844-2330887)
chr7 (143-224)||(1549746-1549827)
chr7 (181-224)||(2338700-2338743)


Alignment Details
Target: chr7 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 3)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 181 - 224
Target Start/End: Complemental strand, 2330887 - 2330844
Alignment:
181 ggttcacaatatgcaataatgctttgagttcttgactcatgagt 224  Q
    ||||||||||||||||||||||||||||||| ||||||||||||    
2330887 ggttcacaatatgcaataatgctttgagttcatgactcatgagt 2330844  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 143 - 224
Target Start/End: Original strand, 1549746 - 1549827
Alignment:
143 acactcaacttaattaatttggaagtataactttcagaggttcacaatatgcaataatgctttgagttcttgactcatgagt 224  Q
    |||||||||||||||||||  ||||| |  ||||||  |||| |||||||| ||||| ||||||||||||||||||| ||||    
1549746 acactcaacttaattaattccgaagtttttctttcaatggtttacaatatgaaataacgctttgagttcttgactcaagagt 1549827  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 181 - 224
Target Start/End: Complemental strand, 2338743 - 2338700
Alignment:
181 ggttcacaatatgcaataatgctttgagttcttgactcatgagt 224  Q
    ||||||||||||| ||||||||||||| ||||||||||||||||    
2338743 ggttcacaatatggaataatgctttgaattcttgactcatgagt 2338700  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University