View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10049_low_47 (Length: 226)
Name: NF10049_low_47
Description: NF10049
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10049_low_47 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 146; Significance: 5e-77; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 11 - 202
Target Start/End: Complemental strand, 48748261 - 48748070
Alignment:
Q |
11 |
agcaaagggagtgagatgcggggaaaattagatgattgtaaattaaatttgtatannnnnnngacaaaataaatttatttattgctattttgtcttatat |
110 |
Q |
|
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
48748261 |
agcaaaaggagtgagatgcggggaaaattagatgattgtaaattaaatttgtatatttttttgacaaaataaatttatttattgctattttgtcttatat |
48748162 |
T |
 |
Q |
111 |
aggtttacaaataaaataataagacctgtatatttagtataagataagatgagcannnnnnnccttgactagaaaaatgataatagattata |
202 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
T |
48748161 |
aggtttacaaataaaataataagacctgtatatttagtataagataagatgagcatttttttccttgactagaaaaatgataatagattata |
48748070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University