View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10049_low_50 (Length: 214)
Name: NF10049_low_50
Description: NF10049
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10049_low_50 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 154; Significance: 7e-82; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 154; E-Value: 7e-82
Query Start/End: Original strand, 14 - 196
Target Start/End: Complemental strand, 36779749 - 36779567
Alignment:
| Q |
14 |
cataggtcatatatccccttcagttggagacctctcttatctcgaaagactcgaattcaaccaattacccaatgtcacaggtcaaatcccttccaccatt |
113 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36779749 |
cataggtcatatatccccttcagttggcgacctctcttatgtcgaaagactcgaattcaaccaattacccaatgtcacaggtcaaatcccttccaccatt |
36779650 |
T |
|
| Q |
114 |
tccaagctnnnnnnnctcaagtatcttacaatctccgggaccagtgtctcaggcccaataccttcttttttgggccaatttaa |
196 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36779649 |
tccaagctcaaaaacctcaagtatcttacaatctccgggaccagtgtctcaggcccaataccttcttttttgggccaatttaa |
36779567 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University