View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10050_9 (Length: 310)
Name: NF10050_9
Description: NF10050
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10050_9 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 85; Significance: 2e-40; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 89 - 198
Target Start/End: Complemental strand, 20381425 - 20381320
Alignment:
| Q |
89 |
aatcttattctctaagaatatgattctgtcgtatctaactcccttgcctgccattcgcaacatacaaaataatttgactttgtaaaatatttcatctcat |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
20381425 |
aatcttattctctaagaatatgattctgtcgtatctaactcccttgcc----attcgcaacatacaaaataatttgactttgtgaaatatttcatctcat |
20381330 |
T |
 |
| Q |
189 |
ccacaggttc |
198 |
Q |
| |
|
||||| |||| |
|
|
| T |
20381329 |
ccacaagttc |
20381320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 70; Significance: 1e-31; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 205 - 282
Target Start/End: Complemental strand, 24525278 - 24525201
Alignment:
| Q |
205 |
ttcactgcaagattgcaacaagttgaatccattgaagacatttgtagggttggttctaaaggatgagataatgggagt |
282 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
24525278 |
ttcattgcaagattgcaacaagttgaatccattgaagacatttgtagggttggttctaaaggatgagattatgggagt |
24525201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 68; Significance: 2e-30; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 205 - 284
Target Start/End: Complemental strand, 9123410 - 9123331
Alignment:
| Q |
205 |
ttcactgcaagattgcaacaagttgaatccattgaagacatttgtagggttggttctaaaggatgagataatgggagtta |
284 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||| |
|
|
| T |
9123410 |
ttcattgcaagattgcaacaagttgaatccattgaagacatttgtagggttggttctaaaggatgatattatgggagtta |
9123331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 205 - 284
Target Start/End: Complemental strand, 9131517 - 9131438
Alignment:
| Q |
205 |
ttcactgcaagattgcaacaagttgaatccattgaagacatttgtagggttggttctaaaggatgagataatgggagtta |
284 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||| |
|
|
| T |
9131517 |
ttcattgcaagattgcaacaagttgaatccattgaagacatttgtagggttggttctaaaggatgatattatgggagtta |
9131438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University