View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10050_low_1 (Length: 202)
Name: NF10050_low_1
Description: NF10050
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10050_low_1 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 156; Significance: 4e-83; HSPs: 5)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 156; E-Value: 4e-83
Query Start/End: Original strand, 13 - 180
Target Start/End: Original strand, 5508734 - 5508901
Alignment:
Q |
13 |
acctgtgggaaacctcctaatagacaacctaagaatttggactctaagggtcaggggaatcatgcctctaatggattctttgatacaaaaagtgaacaaa |
112 |
Q |
|
|
|||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
5508734 |
acctgtggaaaacctcctaatagacaacctaagaatttggactctgagggtcaggggaatcatgcctctaatggattctttgatacaaaaagtgaacaaa |
5508833 |
T |
 |
Q |
113 |
tgtttctagtgtctgatgatttgaagattgtgccaagttccttgctgaactccatgcagatgttgctg |
180 |
Q |
|
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
5508834 |
tgtttctagtgtctgatgatttgaagattttgccaagttccttgctgaactccatgcagatgttgctg |
5508901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 37; E-Value: 0.000000000004
Query Start/End: Original strand, 13 - 177
Target Start/End: Original strand, 5487485 - 5487649
Alignment:
Q |
13 |
acctgtgggaaacctcctaatagacaacctaagaatttggactctaagggtcaggggaatcatgcctctaatggattctttgatacaaaaagtgaacaaa |
112 |
Q |
|
|
|||||||| ||||| ||||| ||| |||||||||||||||||| | ||||| |||||| ||||| ||||| |||||| | | ||| || | | |
|
|
T |
5487485 |
acctgtggaaaacccattaataaacagcctaagaatttggactctgatggtcaagggaataatgcccaaaatggggtctttgtaagagaaaatggatcat |
5487584 |
T |
 |
Q |
113 |
tgtttctagtgtctgatgatttgaagattgtgccaagttccttgctgaactccatgcagatgttg |
177 |
Q |
|
|
||||||| |||||||||||||||||||||||| || ||||||||| |||| ||||||||||| |
|
|
T |
5487585 |
tgtttctggtgtctgatgatttgaagattgtgacagactccttgctgtcctccgtgcagatgttg |
5487649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 121 - 184
Target Start/End: Complemental strand, 5999102 - 5999039
Alignment:
Q |
121 |
gtgtctgatgatttgaagattgtgccaagttccttgctgaactccatgcagatgttgctggaat |
184 |
Q |
|
|
|||| ||||||||||||||||||||| ||||| ||| ||| ||||||||||||||| |||||| |
|
|
T |
5999102 |
gtgtatgatgatttgaagattgtgcctagttctttggtgagttccatgcagatgttgatggaat |
5999039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 111 - 152
Target Start/End: Complemental strand, 5437128 - 5437087
Alignment:
Q |
111 |
aatgtttctagtgtctgatgatttgaagattgtgccaagttc |
152 |
Q |
|
|
||||||||| |||||||||||||| ||||||||||||||||| |
|
|
T |
5437128 |
aatgtttctggtgtctgatgatttaaagattgtgccaagttc |
5437087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 113 - 154
Target Start/End: Complemental strand, 5458467 - 5458426
Alignment:
Q |
113 |
tgtttctagtgtctgatgatttgaagattgtgccaagttcct |
154 |
Q |
|
|
||||||| ||||| |||||||| ||||||||||||||||||| |
|
|
T |
5458467 |
tgtttctggtgtccgatgatttaaagattgtgccaagttcct |
5458426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University