View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10051_high_7 (Length: 245)
Name: NF10051_high_7
Description: NF10051
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10051_high_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 1 - 235
Target Start/End: Complemental strand, 10078765 - 10078531
Alignment:
Q |
1 |
ttgctgtctagcgttcatagagttctggtggagaagtccaacaatggtgcttgtggtggtcgatgcagatgctgaattgacattgttatttacacttacc |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
10078765 |
ttgctgtctagcgttcatagagttctggtggagaagtccaacaatggtgcttgtggtggtcgatgcagatgctgaattgacattgttatttacacttacc |
10078666 |
T |
 |
Q |
101 |
acaccattgttagaagggacttgcatagcagcagcttgcacagagttttgatcaccatttgagttgggggccaccatatgctgctgttgctgctgtaatt |
200 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
T |
10078665 |
acaccattgttagaagggacttgcatagcagcagcttgcacagagttttgatcaccatttgagttgggggccaccatatgctgttgttgctgctgtaatt |
10078566 |
T |
 |
Q |
201 |
gttcttcagactgttgcgcctgattatgatgtcca |
235 |
Q |
|
|
| ||||||||||||||||||||||||||||||||| |
|
|
T |
10078565 |
gatcttcagactgttgcgcctgattatgatgtcca |
10078531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 53; Significance: 2e-21; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 5 - 165
Target Start/End: Original strand, 40776158 - 40776318
Alignment:
Q |
5 |
tgtctagcgttcatagagttctggtggagaagtccaacaatggtgcttgtggtggtcgatgcagatgctgaattgacattgttatttacacttaccacac |
104 |
Q |
|
|
||||||| |||| |||||| |||||||||||||||||||| ||||||||||| || ||||| || || || |||||| |||||||||| |||| || |
|
|
T |
40776158 |
tgtctagaattcacagagttttggtggagaagtccaacaatagtgcttgtggttgttgatgcggacgccgagttgacagaactatttacactaaccatac |
40776257 |
T |
 |
Q |
105 |
cattgttagaagggacttgcatagcagcagcttgcacagagttttgatcaccatttgagtt |
165 |
Q |
|
|
||||| | |||| | |||||| | |||||||||||| | ||||||||| ||||||||||| |
|
|
T |
40776258 |
cattgctggaagcaatttgcatggaagcagcttgcactgggttttgatcgccatttgagtt |
40776318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University