View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10051_low_3 (Length: 300)
Name: NF10051_low_3
Description: NF10051
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10051_low_3 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 7 - 297
Target Start/End: Original strand, 51730267 - 51730557
Alignment:
| Q |
7 |
ttaattacataaaaattcataatcaagtaacttgagagtaggttttaattaattaccttggtttgcatgtgcacactccatgactaaatcgatagcagat |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51730267 |
ttaattacataaaaattcataatcaagtaacttgagagtaggttttaattaattaccttggtttgcatgtgcacactccatgactaaatcgatagcagat |
51730366 |
T |
 |
| Q |
107 |
tttttgaaaccaacgaccacaacctttttgttgttgggaagttggttagcagcatgttggtcaagtttagaataatcaagcgaatgcaggaccttgccat |
206 |
Q |
| |
|
|||||||||||||| || |||||||||||||||||| ||||||| |||||||| ||||||||||||||| | |||||||| | ||| ||||| ||||||| |
|
|
| T |
51730367 |
tttttgaaaccaaccacaacaacctttttgttgttgagaagttgattagcagcttgttggtcaagtttacagtaatcaagtgtatgtaggacattgccat |
51730466 |
T |
 |
| Q |
207 |
tgaatacctcagggccttttttgtgtggaaatactggaatctttggtatgtccccatttttccctaagcaaaccacaacaaacacgaaact |
297 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||| ||||||||||||| |||||| | ||||||||| |||||| ||||||| |
|
|
| T |
51730467 |
tgaatacctcagggccttttttgcatggaaatactggaatcttaggtatgtccccatatttcccaacgcaaaccaccacaaactcgaaact |
51730557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 38; Significance: 0.000000000002; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 59 - 132
Target Start/End: Original strand, 19190916 - 19190989
Alignment:
| Q |
59 |
ttaccttggtttgcatgtgcacactccatgactaaatcgatagcagattttttgaaaccaacgaccacaacctt |
132 |
Q |
| |
|
|||||||||||||| ||||||||||||||| ||| ||| ||||| ||||||||| |||| || || |||||||| |
|
|
| T |
19190916 |
ttaccttggtttgcctgtgcacactccatggctagatcaatagctgattttttgtaacccacaacgacaacctt |
19190989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 59 - 135
Target Start/End: Original strand, 6897609 - 6897685
Alignment:
| Q |
59 |
ttaccttggtttgcatgtgcacactccatgactaaatcgatagcagattttttgaaaccaacgaccacaaccttttt |
135 |
Q |
| |
|
|||||||||||| | |||||||| |||||| | | ||| |||| |||||||||||||||| |||||||| ||||| |
|
|
| T |
6897609 |
ttaccttggttttcctgtgcacattccatggcaatatcagtagctgattttttgaaaccaatcaccacaactttttt |
6897685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University