View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10051_low_8 (Length: 241)
Name: NF10051_low_8
Description: NF10051
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10051_low_8 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 12875080 - 12875303
Alignment:
Q |
1 |
tacttttttcctatctctttacatgattcacattttaaattctgaaaatcaaagatatttttaggttttttaggggcaagcaagaggcatgagagaggca |
100 |
Q |
|
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
12875080 |
tacttttttcctatctctttacatgattcgcattttaaattctgaaaatcaaagatatttttaggttttttaggggcaagcaagaggcatgagagaggca |
12875179 |
T |
 |
Q |
101 |
aataatttctcaaaaaattactatgtttcttttgtcatttttggcataaaagaaagcccaaacccaaagaaattaaaaagtgaatgaaactaagaaatta |
200 |
Q |
|
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
T |
12875180 |
aataatttctcaaaaaattactatgtttcttttgttatttttggcataaaagagagcccaaacccaaagaaattaaaaagtgaatggaactaagaaatta |
12875279 |
T |
 |
Q |
201 |
agcaaacacttttagacatataaa |
224 |
Q |
|
|
||| |||||||||| ||||||||| |
|
|
T |
12875280 |
agcgaacacttttaaacatataaa |
12875303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University