View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10052_high_3 (Length: 440)
Name: NF10052_high_3
Description: NF10052
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10052_high_3 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 219; Significance: 1e-120; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 208 - 430
Target Start/End: Complemental strand, 28789880 - 28789658
Alignment:
| Q |
208 |
gaagtaaaccctagcagccgcggatccaaggtttccaatcatggcggatgttgaaccagaggtagcagcacatggagtggcaaagaagagaacattcaag |
307 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28789880 |
gaagtaaaccctagcagccgcagatccaaggtttccaatcatggcggatgttgaaccagaggtagcagcacatggagtggcaaagaagagaacattcaag |
28789781 |
T |
 |
| Q |
308 |
aagttcagtttccgtggagttgatctcgatgctcttttggatatgcccactgatgaacttgtgaagcttttctctgcacgtgcccgaagaaggtttcgac |
407 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28789780 |
aagttcagtttccgtggagttgatctcgatgctcttttggatatgcccactgatgaacttgtgaagcttttctctgcacgtgcccgaagaaggtttcgac |
28789681 |
T |
 |
| Q |
408 |
gtggtttaacccgcaagcctatg |
430 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
28789680 |
gtggtttaacccgcaagcctatg |
28789658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 139 - 184
Target Start/End: Complemental strand, 28789955 - 28789910
Alignment:
| Q |
139 |
gaatattgaatagttagtaggggatttaaaagacaaacatatgagg |
184 |
Q |
| |
|
|||||| ||||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
28789955 |
gaatatggaatagttagtagggtatttaaaagacaaacataagagg |
28789910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 92 - 122
Target Start/End: Complemental strand, 28790002 - 28789972
Alignment:
| Q |
92 |
gagtaaggcaaacatgaatattgaatagttc |
122 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
28790002 |
gagtaaggcaaacatgaatattgaatagttc |
28789972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 108; Significance: 4e-54; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 108; E-Value: 4e-54
Query Start/End: Original strand, 250 - 401
Target Start/End: Original strand, 31246372 - 31246523
Alignment:
| Q |
250 |
ggcggatgttgaaccagaggtagcagcacatggagtggcaaagaagagaacattcaagaagttcagtttccgtggagttgatctcgatgctcttttggat |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||| |||||||||||||||| |||||||||||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
31246372 |
ggcggatgttgaaccagaggtagcagcacaaggagtgccaaagaagagaacatttaagaagttcagtttccgtggtgttgatctcgatgctctcttggat |
31246471 |
T |
 |
| Q |
350 |
atgcccactgatgaacttgtgaagcttttctctgcacgtgcccgaagaaggt |
401 |
Q |
| |
|
||| |||||||||||||||| |||||||||||| | ||||| || ||||||| |
|
|
| T |
31246472 |
atgtccactgatgaacttgtcaagcttttctcttctcgtgcacgtagaaggt |
31246523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 45; Significance: 2e-16; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 290 - 402
Target Start/End: Complemental strand, 44327172 - 44327060
Alignment:
| Q |
290 |
aagaagagaacattcaagaagttcagtttccgtggagttgatctcgatgctcttttggatatgcccactgatgaacttgtgaagcttttctctgcacgtg |
389 |
Q |
| |
|
|||||||||||||||||||||||||||||| | ||||||||| | ||||| ||| | || ||| |||||||||| ||||| ||||| ||| ||| |||| |
|
|
| T |
44327172 |
aagaagagaacattcaagaagttcagtttcagaggagttgatttggatgcacttcttgacatgtccactgatgagcttgttaagctcttcagtgctcgtg |
44327073 |
T |
 |
| Q |
390 |
cccgaagaaggtt |
402 |
Q |
| |
|
| || |||||||| |
|
|
| T |
44327072 |
ctcgtagaaggtt |
44327060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University