View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10052_high_8 (Length: 322)
Name: NF10052_high_8
Description: NF10052
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10052_high_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 267; Significance: 1e-149; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 267; E-Value: 1e-149
Query Start/End: Original strand, 19 - 309
Target Start/End: Complemental strand, 40127493 - 40127203
Alignment:
Q |
19 |
cgattagcccaagtcgtggatcagatccggaatgtgatagaggccaatgaaggaaagggagagaaagatatgaggagtgtggtgttaaaaagctctacca |
118 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||| |
|
|
T |
40127493 |
cgattagcccaagtcgtggatcagatccggaatgtgatagaggccaatgaaggaaagggagataaagatatgaggagtgtggtgttaaaaagctccacca |
40127394 |
T |
 |
Q |
119 |
ccgggcacagtcataccgaacggaggctccaccagatgatgtacgcagccggtgactacgagagttgtcatgcctgccacggggataatgacagtgagca |
218 |
Q |
|
|
|||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
40127393 |
ccgggcacagtcatactgaacggaggctccaccagatgatgtacgcagccagtgactacgagagttgtcatgcctgccacggggataatgacagtgagca |
40127294 |
T |
 |
Q |
219 |
caaaaggcagtatgatgggacccatgtttcggtagatagataccaggggagagattactgggtggtgaatgtgagaagccaagatcgtcct |
309 |
Q |
|
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
T |
40127293 |
caaaaggcagtatgatgggacccatgtttcggtggatagataccaggggagagattactgggtggtgaatgtgagaagccgagatcgtcct |
40127203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University